Genetic Diversity of Cyprinus carpio var. communis, Cyprinus carpio var. specularis and Carassius carassius by DNA Based Markers  

Asifa Wali1 , Mudasir Syed2 , Bilal Ahmad Bhat1 , Masood-ul Hassan Balkhi1 , Farooz Ahmad Bhat1 , Mohd Maqbool Darzi3
1 Faculty of fisheries Sher-e-Kashmir University of Agricultural Sciences and Technology, Kashmir, Shuhama Srinagar -19006, India
2 Division of Biotechnology, Faculty of Veterinary Sciences and Animal Husbandry, Shuhama. Sher-e- Kashmir University of Agricultural Sciences and Technology, Kashmir, Shuhama Srinagar -19006, India
3 Division of Pathology, Faculty of Veterinary Sciences and Animal Husbandry, Shuhama. Sher-e-Kashmir University of Agricultural Sciences and Technology, Kashmir, Shuhama Srinagar -19006, India
Author    Correspondence author
International Journal of Aquaculture, 2013, Vol. 3, No. 24   doi: 10.5376/ija.2013.03.0024
Received: 29 Jul., 2013    Accepted: 22 Aug., 2013    Published: 02 Oct., 2013
© 2013 BioPublisher Publishing Platform
This is an open access article published under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Preferred citation for this article:

Wali et al., 2013, Genetic Diversity of Cyprinus carpio var. communis, Cyprinus carpio var. specularis and Carassius carassius by DNA Based Markers, International Journal of Aquaculture, Vol.3, No.24 138-146 (doi: 10.5376/ija.2013. 03.0024)

Abstract

To study genetic relationship of Cyprinus carpio var. communis, Cyprinus carpio var. specularis and Carassius carassius collected from different locations of Kashmir, India, two molecular approaches viz. PCR-RFLP of Cyt b gene and random amplified polymorphic DNA (RAPD) were used. Twenty five samples for each of the species collected from different locations of Kashmir, India were used for this study. Of the 12 random primers used 8 generated the polymorphism, while as four out of 7 restriction enzymes used gave polymorphic restriction patterns. The average proportion of polymorphic markers across restriction endonucleases was 74.4%, whereas random primers showed 82.23% polymorphism. The study showed RAPD marker efficiently helped in inter- and intra-species variation of the species. In contrast PCR- RFLP showed bias in detecting intraspecific variations. However, it was found an efficient tool for inter-specific variation between the species under study. The unweighted pair group method with averages (UPGMA) was used to construct two separate dendrogram for RAPD and PCR-RFLP which resulted in two clusters, one containing C. c. communis and C. c. specularis and the other included the C. carassius species. The Phylogenetic analysis demonstrated that scale carp (C. c. communis) is closest to mirror carp (C. c. specularis) than crucian carp (Crassius carassius). Mean values of haplotype and nucleotide diversity across the species were 0.0200 and 1.0000±0.0113, respectively. Adding more populations with increased sample size of each species will be imperative to draw more definitive conclusions about species characterization within this region.

 

Keywords
Cyprinidae; Genetic diversity; RAPD; PCR-RFLP; Cyt b

All organisms including fishes are subjected to mutations due to cellular interactions with the environment they live in; leading to polymorphism and genetic variability among species. Genetic variation in a species enhances the capability of organism to adapt to changing environment and is necessary for survival of the species (Fisher 1930). A wide range of molecular marker systems have been used for the study of intraspecific variation among carps including microsatellites (Crooijmans et al., 1997), random amplified polymorphic DNA (RAPDs; Bartfai et al., 2003) and restriction fragment length polymorphisms (RFLPs; Jian et al., 2003; Kohlmann et al., 2003). Techniques using mtDNA have been widely employed for genetic studies in aquaculture because this molecule has several useful characteristics including a rapid rate of mutation that makes it effective for detecting recent population isolation (Ward and Grewe, 1994) and for establishing genealogical relationships among populations within species (Avise, 2000).

Common carp (Cyprinus carpio L.) and crucian carp (Carassius carassius) belongs to the largest family of cyprinidae among freshwater teleosts (Nelson, 1994). Common carp was introduced in Kashmir, India in 1956 (Das and Subla, 1964). Whereas there is no published record regarding the introduction of C. carassius in this region. It is believed that the fish might have got introduced accidentally with the introduction of Cyprinus carpio (Yousuf, 1996). A voluminous literature reveals that no molecular and genetic efforts were carried out for understanding genetic relations of these species found in Kashmir. Earlier studies remained restricted to morpho-taxonomical studies that are obviously not ultimate tool for characterization of any species. The information on the genetic structure of fish species is useful for optimizing identification of stocks, stock enhancement, breeding programs, management for sustainable yield and preservation of genetic diversity (Dinesh et al., 1993; Garcia and Benzie 1995).The use of DNA markers can contribute significantly to the development and implementation of genetic improvement programs. Genetic improvement programs in terrestrial species benefit greatly from knowledge of pedigree and individual performance. Properly designed breeding programs can make appropriate use of additive and non-additive genetic variation for traits of economic importance and minimize the negative effects of inbreeding.
The present study was undertaken to study genetic diversity in common carp and crucian carp species with following objectives: i) study polymorphism using randomly amplified polymorphic DNA (RAPD), ii) study genetic variability of the species by restriction fragment length polymorphism (PCR-RFLP) of cytochrome b gene, and ii) Compare the efficacy of both the methods in determining genetic variability.
1 Results
A total of 75 specimens (25 from C.c.communis, 25 from C.c.specularis and 25 from Carassius carassius) were analyzed. Among the 12 random primers used for the initial screening, only eight yielded optimum RAPD profiles with all the species under study (Table 1). A total of 3371 polymorphic markers were generated using these primers as shown in. The number of bands ranged from 4-12 per species and the amplified products varied in size between 100-1400bp. The average number of bands per primer ranged between 182 (S-131) and 497 (S-159) with a mean of 421.3. Primer S-159 produced the highest number of fragments among the primers used with an average of 12 fragments, and primer S-131 produced the lowest number of fragments with an average of 5 bands. The total number of RAPD bands produced was 3371 bands, of which 3008 bands were polymorphic in entire population. The proportion of polymorphic markers across the primers ranged between 79.75% and 97.96% with an average of 89.23%.


Table 1 Comparison of genetic diversity and dissimilarity coefficients among 75 specimens of two Cyprinidae species

RAPD data from the 8 primers were used for cluster analysis. The primers with G
+C content above 60% resulted in better polymorphism. The average proportion of polymorphic markers across the primers was 89.23%, ranging between 79.7 % (S-111) to 97.96% (S-161). The large number of exclusive markers account for a substantial portion of the genetic diversity as illustrated by the mean Shannon index per primer 1.36 with values ranging from 0.91 (S-131) to 3.35 (S-111) shown in (Table 1 and Figure1).


Figure 1 RAPD patterns of 75 specimens of two Cyprinidae species; Sc (1-25) is Cyprinus carpiovar. communis , Mc (1-25) is Cyprinus carpiovar. specularis and Cc (1-25) is Carassius carassius produced by primer S-161, M is 1 kb ladder (Gene RularTM 100 bp plus) and N is negative control

For further analysis, one way ANOVA was performed for all the species and the result revealed the non-significant difference i.e. P>0.05 for both polymorphic and non-polymorphic banding pattern. A positive correlation (r =0.369) was obtained between polymorphic and non-polymorphic band using Karl Pearson’s formula.
From clustering analysis UPGMA dendrogram revealed that crucian carp distributed in III cluster displayed maximum dissimilarity coefficient of 0.49 with other individuals, while, other two species i.e. Scale carp and Mirror carp clearly distributed in two clusters I and II respectively as shown in Figure 2. The RAPD analysis proved to be an effective and efficacious technique to measure the magnitude of diversity and polymorphism of the species.


Figure 2 Comparison of two dendrograms obtained with RAPD and PCR-RFLP analyzed for 75 individuals of two Cyprinidae species. See Table 2 for specimen codes


Table 2 List of two Cyprinidae species sampled for DNA extraction

Of the seven restriction endonucleases used, four restriction endonuclease enzymes viz.,MboI, BsuI, MspI, Hin6I (Fermentas, Life Sciences) were found efficiently producing polymorphic patterns in Cytbregion (Table 3 and Figure 3). A total of 32 restriction bands were observed with these enzymes.


Table 3 Comparison of genetic diversity and dissimilarity coefficients among 75 individuals of Cyprinidae species by PCR-RFLP


Figure 3 Restriction digestion profiles of Cyt b gene by MboI in two Cyprinidae species. Sc is Cyprinus carpio communis, Mc Cyprinus carpio specularis and Cc. Carassius carassius

The band size varied from 100 to 600 bp. The average number of bands per enzyme ranged between 8 (MspI) and 10 (MboI) with a mean of 8.0. The proportion of polymorphic markers across the enzymes ranged from 50% to 87.5% with an average of 74.4%. Restriction digestion with the above four enzymes showed that the total size of the bands was always near to the expected size (680 bp). The replication digestion was performed with each of the screened restriction enzymes for at least two times to check the reproducibility. A total of 2-4 polymorphic restriction fragments were observed in each of the species with each enzyme. Restriction enzyme MboI and BsuRI efficiently generates fragments in all the species. The size in the restriction fragment with MboI varied from 155 bp to 300 bp in C.c. communis, 174 bp to 300 bp in C.c. specularis and 167 bp to 300 bp in C. carassius. Also, the size in the restriction fragment with BsuI varied from 170 bp to 308 bp in C.c. communis, 170 bp to 308 bp in C.c. specularis and 296 bp to 493 bp in C. carassius. Hin6I showed the varied size of restriction fragments in C.c. specularis and C. carassius varying in size from 105 bp to 392 bp and 204 bp to 523 bp respectively. However, no restriction site of Hin6I was found in C.c. communis. Furthermore, MspI showed the varied size of restriction fragments in C.c.communis and C. carassius varying in size from 178 bp to 317 bp and 178 bp to 317 bp respectively, no restriction site of MspI was found in C.c. specularis.
Based on Shannon’s index (H) of combined fragment size patterns averaged with four restriction enzymeswas 0.58 with values ranging from 0.23 to 0.29 which attributes to differences among the populations shown in Table 3. Further genetic differentiation for haplotype diversity between and within populations of two species were studies ARLEQUIN version 3.1 software package (Tajima, 1993; Nei, 1987). The mean nucleotide diversity of all the species was 1.0000±0.0113 and the value of mean haplotype diversity was 0.0200. As expected the value for nucleotide diversity were similar (1.0000±0.0113) for all the species. It is evident that the low number of nucleotide substitutions between the haplotypes determined the low indices of genetic diversity (1.0000±0.0113). Hierarchic analysis of interspecies haplotype differences was performed by one way ANOVA (Tajima, 1993) shown in Table 4.


Table 4 AMOVA design and results Hierarchical analysis of inter-population haplotype differences in two Cyprinidae species
 
Further to estimate the pairwise genetic distancebetween 75 individuals Jaccard’s similarity coefficientwas used. From cluster analysis UPGMA dendrogram revealed that Crucian carp i.e. Cc-1 to Cc-25 distributed in III cluster displayed maximum dissimilarity coefficient of 0.38 with other individuals, while other two species i.e. Scale carp and Mirror carp clearly distributed in two clusters I and II resp. shown in Figure 2. The distribution of different individuals revealed that there were 25 individuals in cluster I i.e., Sc-1 to Sc-25 in cluster II i.e., Mc-1 to Mc-25. The PCR-RFLP results showed no polymorphism within the species. However, the marker clearly helps in diversifying the species.
In case of RAPD, among all the primers S-145, S-71, S-159 and S-161 generated robust banding pattern and was found suitable for the species characterization. However, in RFLP MboI and BsuRI was best suited for species discrimination. In contrast S-131 and Hin6I and MspI were least informative for polymorphism. Cluster analysis (UPMGA) was used to generate two independent dendrograms for the two types of markers (Figure 2). As expected in the dendrogram generated by the RAPD and PCR-RFLP, the individuals were grouped according to the species. The cluster I consists of C.c. communis, whereas cluster II and III represents C.c specularis and C.carassius respectively in both RAPD and RFLP. As expected the high value of cluster information was found in case of RAPD and RFLP helped in species discrimination. Further, the result obtained by two markers showed that C.c. communis and C.c. specularis are closely related with each other than C.carassius.These results above clarified the utility of RAPD in terms of degree of polymorphism, precision of inter- and intra-specific genetic variations in characterizing the fish species. However, PCR-RFLP of Cyt bgene has been found an important marker for inter- specific study of cyprinids.
2 Discussion
PCR based molecular markers are the ideal means of identifying genotypes and following inheritance of economically important characters. Phylogenetic studies specifically attempt to show relationships based on reconstructing the evolutionary history of groups or unique genomic lineages. Phylogenetic analysis of related species can be undertaken in various ways and with various DNA markers. However for closely related species, “gene trees” do not always reflect “species trees”, because of intraspecific heterogeneity (Nei, 1987). Therefore, it is important to compare many Phylogenetic trees, using variety of markers for the development of authentic genetic relationships among closely related species.
The RAPD technique provides an efficient, simple and inexpensive method of generating molecular data. Further, it is highly polymorphic marker and does not require any prior knowledge of the genetic makeup of the organism (Hadrys et al., 1992). In this study suitability and reliability of RAPD markers was assessed for understanding the Phylogenetic relationships among and within the species of cyprinid species. In the present study of 12 decamer primers used to screen DNA samples, 8 (66%) detected scorable polymorphism in banding pattern among all the 75 individuals. Eight selected primers generated a total of 3371 bands of which 3008 were polymorphic. An example of the representative polymorphic profiles of 75 individuals with eight primers is shown in Figure 1. The number of bands per individuals ranged from 4 to 12 and bands amplified ranged in size from 100-1400 bp. The average number of bands per primer ranged between 182 (S-131) and 497 (S-159) with a mean of 421.3. The proportion of polymorphic markers across the primers ranged between 79.75% and 97.96% with an average of 89.23% shown. Rahman et al. (2009) studied genetic variations of wild and hatchery populations of Catla catla by RAPD markers and found overall 54.55% polymorphism. Garg et al. (2010) have also reported an analysis for RAPD to assess the extent of genetic diversity within and between three populations of the catfish, Clarias batrachus and obtained 72 scorable DNA fragments out of which 68 (86.66%) were polymorphic. We found that 89.23% of the loci in our study were polymorphic as compared to the 75% reported by Islam et al (2005) in Catla catla, 55.76% in Oreochromis niloticus. Zaeem and Ahmed (2006), 64.98% in Mystus vittatus by Garg et al. (2009) and 86.66% by Garg et al. (2010) in assessment of genetic diversity of Clarias batrachus.
As reported in this study, after a screen of eight primers, 91.04, 79.7, 95.05, 90.04, 91.14, 97.96, 85.81 and 86.6% polymorphic DNA markers were obtained for C.c. communis, C.c. specularis and C.carassius using primers S-71, S-111, S-131, S-145, S-159, S-161, S-177 and S-187 respectively. The results thus showed usefulness of RAPD markers for studying genetic variation in cyprinidfishes. Species-specific RAPD profiles between the species under study were observed using eight random primers. Similar results were also reported by El-Alfy et al., (2009) assessed genetic variation among nile tilapine fishes by RAPD markers. The UPGMA dendrogramobtained from the RAPD data clearly depicts the relationships among these species. The highest interspecies genetic similarity was exhibited between C.c. communisand C.c. specularis andsupports the hypothesis that these two cyprinids are closely related. Similar type of study was also done in Indian major carps PCR-RFLP of cytochrome b gene has been employed efficiently for the study of genetic variations, identification and resolving taxonomical ambiguity of closed related fish species (Barman et al., 2003).
In our study,comparable levels of genetic polymorphism (50.0%, 72.7%, 87.5% and 87.5%) were obtained by using four restriction endonucleses (MboI, Hin6I, BsuRI and MspI). Some restriction enzymes like MboI and BsuRI generated some unique restriction fragments for the two species, thus indicating the wide genetic base of the Cyprinid species. The presence of the unique composite restriction fragments among the two species indicates the usefulness of the approach for fingerprinting purposes have to be chosen for each species individually. Further our PCR- RFLP results showed the presence of Hin6I and MspI restriction sites in two species C.c. specularis, C. carassius and C.c. communis, C. carassius, respectively.Thus these restriction enzymes can become identification markers for these two species. These findings underline the fact that mtDNA segments are more appropriate for population studies. Our results do showed intraspecific variations using the PCR-RFLP of Cyt b gene. The mean nucleotide diversity of the two species was 1.0000±0.0113 and the value of mean haplotype diversity was 0.0000±0.0000. As expected the value for nucleotide diversity were similar (1.0000±0.0113) for all the species. The result also reported by Nei (1973) evaluated inter population polymorphism through the calculation of means of the differences between the haplotype pairs in the sample and of nucleotide (π) and haplotype (h) diversity (Nei, 1973, 1987). It is evident that the low number of nucleotide substitutions between the haplotypes determined the low indices of genetic diversity (1.0000±0.0113) in the sample of cyprinid species. The diversity was comparable with those obtained earlier based on RFLP analysis of mtDNA (Oleinik and Polyakova, 1994).
The statistical analyses using one way ANOVA also depict 100% variations between the species. Also in our study the value of H is not too high; hence do not represent much diversity. In contrast to the results reported by Hansen and Loeschke (1996) polymorphism was found neither in Danish brown trout (Salmo trutta L.) strains by digestion with 18 restriction enzymes, nor in rainbow trout (Onchorhyncuhus mykiss) using 12 endonucleases (Sajedi et al., 2003). Thus mtDNA is not appropriate for reconstruction of relationships among populations, subspecies that diverged > 10 million years ago (Peacock et al., 2001). Interestingly, the dendrograms generated by RAPD and RFLP resulted showed clustering of C.c. communis and C.c. specularis in one major group and C. carassius into separate group. These results suggested that C.C. communis and C.C. specularis have a common ancestor and are genetically closer to each other than to C. carassius. These results above clarified the utility of RAPD (in terms of degree of polymorphism, precision of inter- and intra-specific genetic variations) in characterizing the fish species. However, PCR-RFLP of Cyt bgene has been found an important marker for inter- specific study of cyprinids. The RAPD assay has been used to construct Phylogenetic trees for resolving taxonomic problems in many organisms (Bardakci and Skibinski, 1994; Barman et al., 2003).
PCR–RFLP of Cyt b cannot help resolve the interspecific relations but Phylogenetic relations among the species under consideration. Mitochondrial DNA variation can resolve relationships of species that have diverged as long as 8-10 million years before present (Peacock et al., 2001). After about 8-10 million years, sequence divergence is too slow to allow sufficient resolution of divergence times. Thus mtDNA is not appropriate for reconstruction of relationships among populations, subspecies and species that diverged>10 million years ago (Peacock et al., 2001). Further the use of more restriction enzymes might offer alternative marker and could make the analysis more explanatory. We also observed intense extra restriction fragments that yield total Cyt blength greater than 680 bp. This is in conformity with the patterns obtained for several restriction enzymes by Wen et al (2005) and Durand et al (2002) in their studies. The intensity of these bands suggests that they occur at the same frequency as those bands of the ‘standard’ repeats. The fact that the fragment size is constant for each restriction enzyme used and that such bands were repeatedly obtained in replicate digestions indicates that they are not the result of partial digestions. There may be possibility that the extra bands observed are a consequence of interlocus length heterogeneity due to low rates of concerted evolution in cyprinid species. Out of the four restriction enzymes MboI and MspI showed higher Cyt bvariations than that by Hin6I and BsuRI. In our study Mitochondrial DNA analysis has proven a powerful tool for assessing intraspecific Phylogenetic patterns in cyprinid species as also reported by (Bernatchez et al., 1992; Avise, 1994). Data confirmed occurrence of variability in the mitochondrial Cyt b is an appropriate tool for studying intraspecific genetic variability among Cyprinidaespecies.
3 Material and Methods
3.1 Fish material
Twenty five specimens for each of the Cyprinidae species viz Cyprinus carpio var. Communis, Cyprinus carpio var. Specularis and Carassius carassius collected from different water bodies of Kashmir, India were analyzed for present study (Table 2 and Figure 4). The fishes were identifies using the taxonomies of Talwar and Jhingran (1991). Muscle tissues samples were preserved in 95% ethanol and subjected for DNA isolation. Voucher specimens were fixed in 10% formalin and preserved in the Museum of Faculty Fisheries Sher-e-Kashmir University of Agricultural Sciences and Technology of Kashmir, India.


Figure 4 Map showing collection sites for 75 specimens of two Cyprinidae species.

3.2
DNA Extraction
Total DNA was isolated by standard proteinase K, phenol/chloroform extraction (Sambrook et al., 1989).Quantity and quality of the DNA samples were estimated by comparing band intensities on a 0.8% agarose gel and by a spectrophotometeric method.
3.3 RAPD Analysis
In total12 decamer RAPD primers were screened and only eight primers (Table 1) were found to efficiently generate the polymorphism. PCR was performed in a volume of 20 µl containing: 10x Taq DNA polymerase buffer, 2.25 mM MgCl2, 0.2 mM of dNTP mix, 0.36 µM of each primer (Sigma Aldrich, USA), 0.4ng genomic DNA, and 1 unit of Taq DNA polymerase (Sigma Aldrich, USA). A control PCR tube containing all components but no genomic DNA was run with each primer to check any contamination. DNA amplification was performed in Master Cycler Gradient (Eppendorf, Germany). After initial incubation for 5 min at 94℃, the samples for enzymatic amplification were subjected to 45 repeats of the following thermal cycle: 1 min 94℃, 1min at 36℃ and 1 min at 72℃, and the final extension at 72℃ for 5 min. After amplification, the reaction products were subjected to electrophoresis in 1.5% agarose gels in 1x TAE buffer at 5 V/cm, stained with ethidium bromide and photographed under UV light with the help of Gel documentation system (Alpha-Innotech, USA). A Gene RularTM DNA Ladder Mix (Bangalore Genei, India) was used as the molecular standard. All the PCR results were tested for reproducibility by at least three times. Bands that did not show fidelity were eliminated.
3.4 PCR-RFLP
The Cytbgene of mtDNA were amplified using two designed forward and reverse primers with following sequences 5’-GTTTGATCCCGTTTCGTGTA- 3’ and 5’- AATGACTTGAAGAACCACCGT -3’ (Briolay et al,1998). PCR was performed in a volume of 50 mL containing 10× reaction buffer, 2 mM dNTPs, 1.5 mM MgCl2, 0.5 mM of each primer, 0.5 units Taq polymerase, and approximately 200 ng DNA template (Sigma Aldrich, USA). The reaction mixtures were incubated in Master Cycler Gradient (Eppendorf, Germany). Thermal cycling comprised of 95℃ for 3 min, followed by 34 cycles of 95℃ for 30 sec. annealing at 55℃ for 30 sec and an extension temperature of 72℃ for 1 min. This was followed by a final extension of 72 ℃ for 5 min. Following restriction endonucleases were used for DNA digestion: MboI, BsuI, MspI, Hin6I (Fermentas, Germany). The digestion was carried overnight following manufacturer’s instructions (Table 3). Restricted DNAs were electrophoresed on 1.5% agarose gels run at 5 V/cm in 1XTAE buffer, stained with ethidium bromide and photographed under UV light with help of Gel documentation (Alpha Innotech Cell Biosciences). Gene RularTM 1Kb DNA Ladder and Gene RularTM (Bangalore Genei, India) 100 bp plus was used as the molecular standards. All the PCR and restriction digestion results were tested for reproducibility.
3.5 Data analysis
For RAPD and PCR-RFLP polymorphic, reproducible amplification/ restriction products were scored as: present (1) or absent (0). Genetic diversity was estimated by the Shannon index (Lewontin, 1972):


Where K is the number of bands produced with the respective primer/restriction enzyme and pi is the frequency of the i-th fragment. To further investigate phonetic relationships among species, the binary matrix was used to cluster individuals using procedure of NTSYS-pc 8.1 (Rohlf, 1993), which uses the unweighted pair group method with arithmetic averages (UPGMA). The estimates of pairwise genetic distance between 75 cyprinid species was based on Jaccard’s similarity coefficient. The ARLEQUIN version 3.1 program (Excoffier et al., 2005) was used to evaluate the variability within populations by haplotype and nucleotide diversity (Nei and Tajima, 1981). Quantitative estimate of mtDNA diversity was performed using ANOVA technique (Excoffier et al., 1992).
Acknowledgements
The authors are highly thankful to the Department of Science and Technology, New Delhi, India for their financial support.The help of P. M. Iqbal for technical assistance is also greatly acknowledged. We appreciate the help and support provided by Prof. Shafiq Ahmad Wani, Director Research, SKUAST-K-India.
References
Ahmed M.M.M., Ali B.A., and EI-Zaeem S.Y., 2004, Application of RAPD markers in fish: Part I – some genera (Tilapia, Sarotherodon and Oreochromis) and species (Oreochromis aureus and Oreochromis niloticus) of Tilapia, International journal of biotechnology, 6: 86-93
http://dx.doi.org/10.1504/IJBT.2004.004615
Avise J.C., 1994, Molecular Markers, Natural History and Evolution. Chapman and Hall, New York, NY.511p.f
Avise J.C., 2000, Phylogeography – The History and Formation of Species. Harvard University Press, USA, pp. 447
Bardakci F., and Skibinski D.O.F., 1994, Application of the RAPD technique in Tilapia fish: species and subspecies identification, Journal of Heredity,73: 117-123
http://dx.doi.org/10.1038/hdy.1994.110
Barman H.K., Barat A., Yadav B., Banerjee S., Meher P.K., Reddy P.V.G.K., and Jana R.K., 2003, Genetic variation between four species of Indian major carps as revealed by random amplified polymorphic DNA assay, Journal of Aquaculture,217 (1–4): 115-123
http://dx.doi.org/10.1016/S0044-8486(02)00357-5
Bartfai R., Egedi S., Yue G.H., Kovacs B., Urbanyi B., Tamas G., Horvath L., and Orban L., 2003, Genetic analysis of two common carp brood stocks by RAPD and microsatellite markers, Aquaculture 219: 157-67
http://dx.doi.org/10.1016/S0044-8486(02)00571-9
Briolay J., Galtier N., Brito R.M., and Bouvey Y., 1998, Molecular phylogeny of Cyprinidae inferred from cytochrome b DNA sequences, Molecular Phylogenetics and Evolution, 9(1): 100-108
http://dx.doi.org/10.1006/mpev.1997.0441
Crooijmans R.P.M., Bierbooms V., Komen J., Vanderpoel J.J., and Groenen M., 1997, Microsatellite markers in common carp (Cyprinus carpio L), Animal Genetics, 28: 129-34
http://dx.doi.org/10.1111/j.1365-2052.1997.00097.x
Das S.M., and Subla B.A., 1964, Ichthyofauna of Kashmir. Part II: The speciation of Kashmir fishes, Ichthyologia, 3: 57-62
Dinesh K.R., Lim T.M., Chua K.L., Chan W.K., and Phang V.P.E., 1993, RAPD analysis; an efficient method of DNA fingerprinting in fishes, Zoological science, 10: 849-854
Durand J.D., Tsigenopoulos C.S., Unlu E., and Berrebi P., 2002, Phylogeny and Biogeography of the Family Cyprinidae in the Middle East Inferred from Cytochrome b DNA— Evolutionary Significance of This Region, Molecular Phylogenetics and Evolution, 22(1): 91-100
http://dx.doi.org/10.1006/mpev.2001.1040
El-Alfy S.H., Abdelmordy M., and Salama M.S., 2009, Genetic variation among Nile tilapiine fishes (Perciformes: Cichlidae) assessed by random amplified polymorphic DNA (RAPD) analysis, Research J. Cell and Mol. Biol, 3(1): 63- 70
Excoffier L., Smouse P.E., and Quattro J.M., 1992, Analysis of Molecular Variance Inferred from Metric Distances among DNA Haplotypes: Application to Human Mitochondrial DNA Restriction Data, Genetics, 131: 479-491
Excoffier L., Laval G., and Schneider S., 2005, Arlequin ver. 3.0: An integrated software package for population genetics data analysis, Evolutionary Bioinformatics, Online 1: 47-50
Fisher R.A., 1930, The Genetical Theory of Natural Selection. Oxford University Press, UK
Garcia D.K., and Benzia J.A.H., 1995, RAPD markers of potential use in Penaeid prawn (Penaeus monodon) breeding programs, Aquaculture, 130: 137-144
http://dx.doi.org/10.1016/0044-8486(94)00311-B
Garg R.K., Sairkar P., Silawat N., Batay N., and Mehrotra N.N., 2010, Assessment of genetic diversity of Clarias batrachus using RAPD markers in three water bodies of Bhopal, Journal of Environmental Biology, 31(5): 749-753
Garg R.K., Silawat N., Sairkar P., Vijay N., and Mehrotra N.N., 2009, RAPD anaslysis for genetic diversity of two populations of Mystus vittatus (Bloch) of Madhya Pradesh, India, Afr J Biotech, 17: 4032-4038
Hadrys H., Balick M., and Schierwater B., 1992, Applications of random amplified polymorphic DNA (RAPD) in molecular ecology, Mol. Ecol, 1: 55-63
http://dx.doi.org/10.1111/j.1365-294X.1992.tb00155.x
Hansen M.M., and Mensberg K.L.D., 1998, Genetic differentiation and relationship between genetic and geographical distance in Danish sea trout (Salmo trutta L.) populations, Heredity, 81: 493–504
http://dx.doi.org/10.1046/j.1365-2540.1998.00408.x
Islam M.S., Ahmad A.S.I., Azam M., and Alam M.S., 2005, Genetic analysis of three river populations of Catla catla (Hamlton) using randomly amplified polymorphic DNA markers, Asin Aust. J. Ani. Sci, 18: 452-457
Jian F.Z., Quing J.W., Yu Z.Y., and Jin T.G., 2003, Genetic divergence between Cyprinus carpio carpio and Cyprinus carpio haematopterus as assessed by mitochondrial DNA analysis, with emphasis on origin of European domestic carp, Genetica, 119, 93-7
http://dx.doi.org/10.1023/A:1024421001015
Kohlmann K., Gross R., Murakaeva A., and Kersten P., 2003, Genetic variability and structure of common carp (Cyprinus carpio) populations throughout the distribution range inferred from allozyme, microsatellite and mitochondrial DNA markers, Aquaculture Living Resources, 16: 421-31
http://dx.doi.org/10.1016/S0990-7440(03)00082-2
Lewontin R.C., 1972, The apportionment of human diversity, Evol. Biol, 6: 381-398
http://dx.doi.org/10.1007/978-1-4684-9063-3_14
Nei M., 1973, Analysis of Gene Diversity in Subdivided Populations, Proc. Natl Acad. Sci. USA, 70: 3321-3323
http://dx.doi.org/10.1073/pnas.70.12.3321
Nei M., 1987, Molecular Evolutionary Genetics, New York: Columbia Univ. Press
Nelson J., 1994, Fishes of the World, 3rd ed. Wiley, New York, NY, 600.
Oleinik A.G., and Polyakova N.E., 1994, Restriction Analysis of the Mitochondrial Genome in the Family Salmonidae, Russ. J. Genet., 30(9): 1043-1050
Peacock M.M., Dunham J.B., and Ray C., (2001) Recovery and Implementation Plan for Lahontan Cutthroat Trout in the Pyramid Lake, Truckee River and Lake Tahoe Ecosystem Genetics Section. Draft Report. Biological Resources Research Center Department of Biology, University of Nevada, Reno, pp 83
Rahman S.M.Z., Khan M., and Islam S.A.S., 2009, Genetic variation of wild and hatchery population of the catla India major carp (Catla catla Hamilton, 1822: Cypriniformes, Cyprinidae) revealed by RAPD marker, Genet. Mol. Biol, 32: 97-201
http://dx.doi.org/10.1590/S1415-47572009005000013
Rohlf F.J., 1993, NTSYS-pc. Numerical taxonomy and multivariate analysis system: version 1.8. Applied Biostatistics, New York
Sajedi R.H., Aminzadeh S., Naderi-Manesh H., Sadeghizadeh M., Abdolhay H., and Naderi-Manesh M., 2003, Genetic variation within and among rainbow trout, Onchorhynchus mykiss, hatchery populations from Iran assessed by PCR-RFLP analysis of mitochondrial DNA segments, J. Food Sci, 68: 870-873
http://dx.doi.org/10.1111/j.1365-2621.2003.tb08258.x
Sambrook J., Fritsch E.F., and Maniatis T., 1989. Molecular Cloning: a laboratory manual. 2nd ed. N.Y., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press. 1659 p. ISBN 0-87969-309-6
Tajima F., and Nei M ., 1981, DNA polymorphism detectable by restriction endonucleases, Genetics, 97: 145-163
Talwar P.K., and Jhingran A.G., 1991, Inland fishes of India and Adjacent Countries. Vol. I, Oxford and IBH publishing Co., New Delhi, pp 268.
Ward R.D., and Grewe P.M., 1994, Appraisal of molecular genetics techniques in fisheries. In: Molecular Genetics in Fisheries (Ed. By T.J. Pitcher), pp. 29–54. Chapman and Hall, UK
Wen F.L., Chyuan Y.S., and Deng F.H., 2005, Identification of Four Thunnus Tuna Species Using Mitochondrial Cytochrome b Gene Sequence and PCR-RFLP Analysis, Journal of Food and Drug Analysis, 13(4): 382-387
Yousuf A.R., 1996, Fishery resource of Kashmir. Pp.75-120. In: Ecology, Environment and Energy. (A. H. Khan and A. K. Pandit eds), University of Kashmir


Zaeem S.Y.E., and Ahmed M.M.M., 2006, Genetic differentiation between sex reversal and normal of Full-Sib Nile Tilapia, Oreochromis niloticus based on DNA fingerprinting, Res. J. Fish. Hydrol., 1: 1-5

International Journal of Aquaculture
• Volume 3
View Options
. PDF(311KB)
. FPDF(win)
. HTML
. Online fPDF
Associated material
. Readers' comments
Other articles by authors
. Asifa Wali
. Mudasir Syed
. Bilal Bhat
. Masood-ul Hassan Balkhi
. Farooz Bhat
. Mohd Darzi
Related articles
. Cyprinidae
. Genetic diversity
. RAPD
. PCR-RFLP
. Cyt b
Tools
. Email to a friend
. Post a comment